#bioinformatics #nanopore #demultiplexing #ont

bin+lib barbell

Extremely fast and accurate Nanopore demultiplexing

2 releases

Uses new Rust 2024

0.3.1 Jan 20, 2026
0.3.0 Nov 22, 2025

#261 in Biology

MIT license

745KB
4.5K SLoC

crates.io Conda version biorXiv preprint

πŸ¦€ Barbell β€” Pattern aware demux

Why Barbell?

  • >1000Γ— fewer trimming errors compared to Dorado.
  • Equivalent or better assemblies.
  • Contamination-free assemblies by removing artefact reads.
  • Easily applicable to custom experiments.
  • Still very fast.

If you have any issues or if something is unclear, just create an issue.



Paper

See the paper for more details on the Barbell scoring and comparisons with other tools:

Barbell Resolves Demultiplexing and Trimming Issues in Nanopore Data

Rick Beeloo, Ragnar Groot Koerkamp, Xiu Jia, Marian J. Broekhuizen-Stins, Lieke van Ijken, Bas E. Dutilh, Aldert L. Zomer
bioRxiv, 2025
https://doi.org/10.1101/2025.10.22.683865


Installing Barbell

Barbell is written in Rust.

Executables

Download the latest release from releases. These are also available via

cargo binstall barbell

or via conda/mamba/pixi:

conda install -c bioconda barbell

Check whether Rust is installed:

rustc --version

If not install it via rustup, more info in their docs. Use rustup update to get the latest stable version.

Then we can install Barbell:

RUSTFLAGS="-C target-cpu=native" cargo install barbell

See here for details on target-cpu=native.


πŸ“Έ Preview

Demo GIF

Quickstart

Barbell includes built-in kit presets for many Nanopore kits (most DNA kits; RNA and Twist kits are an exception). Presets let you run analyses quickly, but we recommend reading Understanding barbell to interpret the results correctly.

Basic command:

barbell kit -k <kit-name> -i <reads.fastq> -o <output_folder> --maximize

The --maximize option is recommended (e.g., for assembly) unless you need an ultra-strict barcode configuration.

Native barcoding example (SQK-NBD114-96)

barbell kit -k SQK-NBD114-96 -i reads.fastq -o output_folder --maximize

This uses a conservative flank-based edit-distance cutoff. If many reads are missed during annotate, you can relax the flank error threshold, for example:

--flank-max-errors 5

β€”but always inspect the results after changing thresholds to avoid random matches (which show up as Fflank matches).

Rapid barcoding example (SQK-RBK114-96)

barbell kit -k SQK-RBK114-96 -i reads.fastq -o output_folder --maximize

For a list of supported kits (see data/supported_kits.txt). Note that we thoroughly tested the rapid and native kits but not others, if you experience any issues please report them. Note, there is an option --use-extended which enables searches for fusion points, and other artefacts. This is around 3 times slower, but worth it if quality is essential (i.e. generating consensus sequences).

General Pointers

  • Too few annotated reads (many missed):
    Slightly increase --flank-max-errors (the automatically derived cutoff is reported).

  • Too many Fflank matches:

    1. Check annotation.tsv to see if matches occur at unexpected locations (not near read ends).
      • Random locations: Lower --flank-max-errors.
      • Non-random locations: Adjust --min-score-diff.

        This is usually unnecessary as defaults are lenient; report an issue if it occurs.

  • Using a kit other than native or rapid and observing unexpected annotations: Please report an issue.


In-depth inspection of Nanopore kit results

Barbell's typical manual workflow: annotate β†’ inspect β†’ filter β†’ trim.

Annotate

Run annotate to find matches in reads and output an annotation table (TSV):

barbell annotate --kit SQK-RBK114-96 -i pass_sample.fastq -t 10 -o anno.tsv

(Using 10 threads.)

Example anno.tsv rows:

read_id read_len        rel_dist_to_end read_start_bar  read_end_bar    read_start_flank        read_end_flank   bar_start       bar_end match_type  flank_cost      barcode_cost    label   strand  cuts
c5f925b2-fc0b-4053-b615-d70950d41436    19783   14      14      104     14      104     0       0       Fflank   14      14      flank   Fwd
dbca7fb9-d6c8-4417-8ae7-bc32ebce9b27    2972    29      48      70      29      111     0       23      Ftag     13      7       BC29    Fwd
6c089f0a-50cd-4215-94f0-c7babb87f5fe    7599    27      51      74      27      121     0       23      Ftag     11      5       BC45    Fwd
..etc

For column descriptions see Output columns (annotate & filter) below.

This file shows, per read, which barcodes/flanks were matched and with what costs. Use inspect next to summarize patterns.

Inspect

Summarize patterns across the annotation file:

barbell inspect -i anno.tsv

By default inspect shows the top 10 pattern groups; use -n <amount> to increase.

Example summary:

Found 64 unique patterns
  Pattern 1: 82421 occurrences
    Ftag[fw, *, @left(0..250)]
  Pattern 2: 5003 occurrences
    Ftag[fw, *, @left(0..250)]__Ftag[fw, *, @right(0..250)]
  Pattern 3: 3545 occurrences
    Fflank[fw, *, @left(0..250)]
  ...
Showed 10 / 64 patterns
Inspection complete!

Some observations:

  • Ftag on the left (@left) is the expected pattern for the rapid barcoding kit - that is good news.
  • A contamination pattern can be a barcode on the left and another barcode on the right (@right). We can decide to just trim of the right side (see filtering later)
  • Fflank indicates that flanks matched but no confident barcode was found.
  • @prev_left indicates additional tags close to a previous element (e.g., double-barcode ligation).

Per-read patterns

To output the selected pattern per read:

barbell inspect -i anno.tsv -o pattern_per_read.tsv

Example pattern_per_read.tsv contents:

85ef... \t Ftag[fw, *, @left(0..250)]
2f67... \t Ftag[fw, *, @left(0..250)]__Ftag[fw, *, @prev_left(0..250)]
...

This is useful when you want to inspect a single "weird" read in detail.

Filter

Create a filters.txt file listing the patterns you want to keep, one per line. For example:

Ftag[fw, *, @left(0..250)]
Ftag[fw, *, @left(0..250)]__Ftag[fw, *, @right(0..250)]
Ftag[fw, *, @left(0..250)]__Ftag[fw, *, @prev_left(0..250)]

Then run:

barbell filter -i anno.tsv -f filters.txt -o filtered.tsv

The resulting filtered.tsv contains only reads that match the specified patterns.

Cutting / trimming metadata

Barbell needs to know where to cut reads for trimming. You mark cut positions by adding >> (cut after this element) or << (cut before this element) inside the tag's bracket list. Where within the brackets does not matter.

Examples (note the comma-separated fields inside the brackets):

Ftag[fw, *, @left(0..250), >>]
Ftag[fw, *, @left(0..250), >>]__Ftag[<<. fw, *, @right(0..250)]
Ftag[fw, *, @left(0..250)]__Ftag[fw, *, @prev_left(0..250), >>]

In the middle pattern we retain the read sequence between the left tag (cut after it) and the right tag (cut before it).

Run filter again (same command as above) to populate the cuts column in filtered.tsv. This is required before trimming.


Trim

Trim reads using the cuts metadata produced by filter:

barbell trim -i filtered.tsv -r reads.fastq -o trimmed

Output files are organized by pattern-based folder/filenames, for example:

BC14_fw__BC14_fw.trimmed.fastq   BC31_fw__BC04_fw.trimmed.fastq  ...

If you prefer different filename conventions, use these flags:

  --no-label               Disable label in output filenames
  --no-orientation         Disable orientation in output filenames
  --no-flanks              Disable flanks in output filenames
  --sort-labels            Sort barcode labels in output filenames
  --only-side <left|right> Only keep left or right label in output filenames

Example to remove orientation and keep only the left label:

barbell trim -i filtered.tsv -r reads.fastq -o trimmed --no-orientation --only-side left

Gives:

BC01.trimmed.fastq  BC11.trimmed.fastq ...

Custom experiment

We first create a Fasta, or multiple Fastas containing your queries depending on whether you have a single-end or dual-end experiment.

Creating a query Fasta

If you have your own barcodes/primers/adapters, create FASTA files containing the full expected sequences. Note that each FASTA contains all sequences that share the same prefix/suffix, and are unique.

The Fasta format should be as follows:

>NB01
<left_flank_sequence><bar1_sequence><right_flank_sequence>
>NB02
<left_flank_sequence><bar2_sequence><right_flank_sequence>
...

Example (adapter + barcode + primer):

>NB01
TCGTTCAGTTACGTATTGCTCACAAAGACACCGACAACTTTCTTAGRGTTYGATYATGGCTCAG
>NB02
TCGTTCAGTTACGTATTGCTACAGACGACTACAAACGGAATCGAAGRGTTYGATYATGGCTCAG

Here:

TCGTTCAGTTACGTATTGCT CACAAAGACACCGACAACTTTCTT AGRGTTYGATYATGGCTCAG
    adapter               barcode                 primer

Barbell extracts the shared prefix (adapter) and shared suffix (primer) as flanks β€” only the barcode region should differ between FASTA entries.

Single end

See above to create a fasta file, say left.fasta for single-end then we can run annotate:

barbell annotate -q left.fasta -b Ftag -i reads.fastq -o anno.tsv -t 10

After that you can follow the same inspect β†’ filter β†’ trim steps described above.

Dual end

For dual-end, we create two FASTAs, left.fasta and right.fasta for example, then we run:

barbell annotate -q left.fasta,right.fasta -b Ftag,Rtag -i reads.fastq -o anno.tsv -t 10

Note: there must be no spaces between the comma-separated file list and the tag list: -q left.fasta,right.fasta -b Ftag,Rtag.

In case you have concatenated reads in your inspect also see concat reads


Custom experiment with mixed sequences

Often we combine multiple samples together which share the same flanks, for example all rapid barcoding. But we could also combine completely different experiments, with different primers for example. How do we demux that?

First go through "custom experiment" setup, then continue reading here how we adjust the query files.

That's quite simple. We create fasta files for all possible groups. Lets say we have:

group1

  • group1_left.fasta: adapter1-barcode-primer1
  • group1_right.fasta: primer1-barcode-adapter1

group2:

  • group2_left.fasta: adapter2-barcode-primer2
  • group2_right.fasta: primer2-barcode-adapter2

Then we make sure our labels in the fasta have some unique substring, like group1 and group2: for example:

group1_left.fasta:

>group1_bar1
AACGACA...

group2_left.fasta:

>group2_bar1
AGGGCAC...

We then run annotate like:

barbell annotate -q group1_left.fasta,group1_right.fasta,group2_left.fasta,group2_right.fasta -b Ftag,Rtag,Ftag,Rtag -i reads.fastq -o anno.tsv -t 10

Note: While you could run annotate separately for each query file, it’s generally better to combine all into a single annotate run (as mentioned here). This way, they are competing with one another.

Then in the filtering step we can create filtered files for each group: (just check inspect first to see your patterns)

group1_filters.txt:

Ftag[fw, ~group1, @left(0..250), >>]__Rtag[<<, rc, ~group1, @right(0..250)]

group2_filters.txt:

Ftag[fw, ~group2, @left(0..250), >>]__Rtag[<<, rc, ~group2, @right(0..250)]

And pull them out!

barbell filter -i anno.tsv -f group1_filters.txt -o group1_reads.tsv
barbell filter -i anno.tsv -f group2_filters.txt -o group2_reads.tsv

and then we can just trim them to separate files:

barbell trim -i group1_reads.tsv -r reads.fastq -o group1_trimmed
barbell trim -i group2_reads.tsv -r reads.fastq -o group2_trimmed

Output columns (annotate & filter)

  • read_id: read identifier as in the provided FASTQ

  • read_len: length of read in bp

  • rel_dist_to_end: relative distance to the read end. >= 0 means X bases from the left end; a negative value means X bases from the right end (e.g. -10 is 10 bp from the right).

  • read_start_bar: start position of the barcode match in the read

  • read_end_bar: end position of the barcode match in the read

  • read_start_flank: start position of the flank match in the read

  • read_end_flank: end position of the flank match in the read

  • bar_start, bar_end: coordinates where the barcode was aligned (previous partial-barcode matches are disabled; full barcode length is expected)

  • match_type:

    • Ftag: forward barcode + flank matched
    • Fflank: forward flank matched (barcode undetectable)
    • Rtag: rear barcode + flank matched
    • Rflank: rear flank matched (barcode undetectable)

    Note: for some kits (e.g., rapid barcoding) there's effectively a single barcode; we still call this Ftag. For native dual barcoding both ends may use the same barcode set; orientation (forward/reverse complement) is available in the strand column.

  • flank_cost: number of edits in the flank sequence (excluding the barcode)

  • barcode_cost: number of edits in the barcode region

  • label: label from your FASTA (or preset kit) β€” e.g., BC14, RBK60, etc.

  • strand: orientation of the match (fw or rc)

  • cuts: empty after annotate; populated after filter to inform trim where to cut


Patterns

Patterns describe how elements are combined in a read. Single elements have the form:

<tag>[<orientation>, <label>, <relative position>, <optional cut specifier>]

Multiple elements are combined with __ (double underscore):

<tag>[...]__<tag>[...]

Fields:

  • tag: Ftag, Fflank, Rtag, Rflank, whether a sequence is Ftag or Rtag is user specified (or within the kit), see custom experiment, the Fflank,Rflank are the "incomplete" forms where the barcode was undetectable.
  • orientation: fw or rc.
  • label: exact label (e.g. NB01), * for any label, or ~substring to match headers containing substring (for an example see custom exp. mixing).
  • relative position: e.g. @left(0..250): to left side of read, @right(0..250): to right side of read, @prev_left(0..250): relative to the previous element.
  • cut specifier (optional): >> (cut after this element) or << (cut before this element).

Examples:

Ftag[fw, *, @left(0..250), >>]
Ftag[fw, *, @left(0..250), >>]__Ftag[<<, rc, *, @right(0..250)]
Ftag[fw, *, @left(0..100), >>]__Rtag[<<, fw, *, @prev_left(1500..1700)]

(for examples of concat reads see concat reads section)

These let you express typical cases such as single-barcode-left, left-and-right barcodes, or expected amplicon sizes via @prev_left.


How to handle concat reads

It is possible that you have concat reads like:

Ftag[fw, *, @left(0..250), >>]__Ftag[<<, rc, *, @pev_left(1500..1750)]__Ftag[fw, *, @prev_left(0..250), >>]__Ftag[<<, rc, *, @right(0..250)]

We always read the pattern from left to right , then we can deduce the read matches looked like this:

[Ftag,fw]---------[Ftag,rc][Ftag, fw]---------[Ftag, rc]

If we want to cut more than once we have to use cut group identifiers, we do this by placing a number after the << or >>:

Ftag[fw, *, @left(0..250), >>1]__Ftag[<<1, rc, *, @pev_left(1500..1750)]__Ftag[fw, *, @prev_left(0..250), >>2]__Ftag[<<2, rc, *, @right(0..250)]

Note the >>1, <<1, >>2, <<2, now barbell knows exactly where you want the reads to be cut.

If the labels were: NB01---NB01-NB02----NB02, barbell will write the first read to the NB01 folder and the second to NB02.

Getting all concats

If concats are a big part of your read set (ideally they are not) their patterns will show up high in inspect anyway, and copying just those will probably be enough. If you really want all the concat reads out you could use the -o in inspect to write the patterns per read. Then, get all unique patterns from there and use a regex or a python script to insert the >>1 and <<1, you can just dump all of them to filters.txt and use that in barbell filter.


Paper evals

Since this involves substantial amount of extra code we moved these to the paper-evals repo. All information on how to reproduce results and set up environments to do so can be found there.


Notes & tips

  • Keep an eye on Fflank matches β€” these are often lower-confidence and may indicate reads with poor barcode sequence quality.
  • Start with conservative filters to see how many reads match expected patterns, then relax thresholds if necessary.
  • When experimenting with custom FASTAs, keep queries clean (shared flanks, differing barcode region only).

Dependencies

~13–28MB
~365K SLoC