Generation of an Artificial Double Promoter for Protein

Expression in Bacillus subtilis through a Promoter Trap

System
Mingming Yang1, Weiwei Zhang1, Shengyue Ji1, Pinghua Cao1, Yulin Chen1*, Xin Zhao1,2*
1 College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi Province, People’s Republic of China, 2 Department of Animal Science, McGill
University, Quebec, Canada

Abstract
Bacillus subtilis is an attractive host for production of recombinant proteins. Promoters and expression plasmid backbones
have direct impacts on the efficiency of gene expression. To screen and isolate strong promoters, a promoter trap vector
pShuttleF was developed in this study. Using the vector, approximately 1000 colonies containing likely promoters from
Bacillus licheniformis genomic DNA were obtained. Amongst them, pShuttle-09 exhibited the highest b-Gal activities in both
Escherichia coli and B. subtilis. The activity of pShuttle-09 in B. subtilis was eight times of that of the P43 promoter, a
commonly used strong promoter for B. subtilis. A sequence analysis showed that pShuttle-09 contained PluxS and truncated
luxS in-frame fused with the reporter gene as well as another fragment upstream of PluxS containing a putative promoter.
This putative promoter was a hybrid promoter and its b-Gal activity was higher than PluxS. Reconstructing the hybrid
promoter from pShuttle-09 to PlapS further improved the b-Gal production by 60%. The usefulness of our promoter trap
system is likely due to random shuffling and recombination of DNA fragments and adoption of a rapid and high-throughput
screening. Thus, our data provide additional evidence to support the concept of using a promoter trap system to create
new promoters.

Citation: Yang M, Zhang W, Ji S, Cao P, Chen Y, et al. (2013) Generation of an Artificial Double Promoter for Protein Expression in Bacillus subtilis through a
Promoter Trap System. PLoS ONE 8(2): e56321. doi:10.1371/[Link].0056321
Editor: Arnold Driessen, University of Groningen, The Netherlands
Received August 15, 2012; Accepted January 8, 2013; Published February 8, 2013
Copyright: ß 2013 Yang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants from Chinese National Natural Science Foundation (30871813 and 31072060). The funder had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: xylgene@[Link] (YC); zhaoxin@[Link] (XZ)

Introduction recruited to the promoter by regulatory proteins binding to specific

sites in the promoter. There are several ways to find new
Bacillus subtilis is a non-pathogenic gram-positive bacterium and promoters. The advent of DNA sequencing has significantly
has been an attractive host for production of recombinant proteins accelerated sequencing of many bacterial genomes and prediction
from both prokaryotic and eukaryotic origins [1], [2], [3]. The of promoters. However, it is not yet possible to scan a bacterial
suitability and popularity of B. subtilis as one of main hosts for genome sequence and readily predict the expression behavior of
recombinant protein production is due to several reasons: genes belonging to a regulon, largely because an accurate
generally recognized as safe as a result of its lack of pathogenicity prediction of promoters is difficult [16]. Alternatively, a promoter
and the absence of endotoxins; capable of secreting functional trap vector, which is a plasmid containing a multiple cloning site at
proteins directly into culture media, easy for genetic manipulation
the 59 end of a promoter-less marker gene, can be used to identify
and handling, and capable of large-scale fermentation [2], [4], [5],
promoters [17], [18], [19]. An unidentified DNA fragment is
[6].
cloned into the multiple cloning site and expression of the marker
B. subtilis own proteins can be over expressed in B. subtilis in the
gene is monitored to identify active promoter elements in the
order of several grams per liter [3]. However, secretion of
unidentified DNA fragment. Promoter trap systems have been
heterologous proteins in B. subtilis is usually low [7]. Thus, efficient
successfully used to identify promoters for B. subtilis either from B.
production of high-value recombinant proteins in B. subtilis
subtilis itself or from other bacillus species [20], [21], [22], [23].
remains a major challenge. To circumvent the problem, strong
A promoter trap system could perform shuffling and recombi-
promoters, a variety of translation/secretion signals, and tran-
scription terminators are continuously being explored. In partic- nation of DNA fragments and screen of strong promoters
ular, several strong promoters have been reported [8], [9], [10], simultaneously. However, this has never being reported. Fortu-
[11], [12], [13], [14], [15]. In spite of the progress, it is still itously, when a promoter trap system was used in this study to
beneficial to find even more potent promoters. screen Sau3A I cut fragments from B. licheniformis genomic DNA
Promoters are important regulatory elements in a genome and for potential promoters, a strong double promoter was identified,
control spatial and temporal expression of genes and their containing a normal promoter and a hybrid promoter due to
expression strength. In bacteria, a promoter is recognized by shuffling and recombination. The putative double promoter was
RNA polymerases and associated sigma factors, which may be further improved and used for protein expression both in E. coli

PLOS ONE | [Link] 1 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

and B. subtilis. Our results show that promoter trap systems could Construction of a promoter trap vector
be suitable for finding novel strong promoters. Using the primer pair bgaB-1 and bgaB-2, the bgaB coding region
was PCR amplified from the plasmid pDL [6]. The amplified
Materials and Methods fragment was flanked by BamH I and Sac I at 59 and 39 ends,
respectively. The promoter trap vector was assembled as follows.
Bacterial strains, plasmids and growth conditions Firstly, the obtained bgaB digested by BamH I and Sac I was
B. subtilis 1A747 (B. subtilis PY79) was a gift from Bacillus cloned into corresponding sites of pGJ103, yielding pGJ-Bga.
Genetic Stock Centre of the Ohio State University. B. pumilus Then, the Apa I-BamH I-treated spectinomycin resistance gene,
BYG, B. licheniformis A061, B. amyloliquefaciens and B. megaterium W-5 which was PCR amplified from the pDG1728 [26] using the
were isolated by our laboratory. The bacterial strains were isolated primer pair spec-1 and spec-2, was inserted into corresponding
from effluent of a paper mill in Hubei province of China and sites of pGJ-Bga, resulting in a promoter trap vector pShuttleF.
partial 16S rDNA sequencing was used for identification of species
in the genus Bacillus. The plasmids used in this study are listed in Cloning of promoter fragments
Table 1. E. coli DH5a was purchased from Novagen (Darmstadt,
The genomic DNA of B. licheniformis was partially digested with
Germany). The bacterial strains were cultured in the Luria-Bertani
Sau3A I, and then ligated with the promoter trap vector pShuttleF
(LB) medium at 37uC. The following concentrations of antibiotics
treated with the BamH I and alkaline phosphatase. The ligation
were used for selection: 100 mg/mL ampicillin (Amp), 5 mg/mL
mixture was transformed into E. coli DH5a and recombinants
chloramphenicol (Cm) and 50 mg/mL spectinomycin (Spec).
harbouring promoter fragments were screened on the LB solid
medium supplemented with X-Gal (20 mg/mL).
PCR and DNA manipulation
Polymerase chain reaction (PCR) primers and oligonucleotides Sequencing and analysis
used in this study are listed in Table 2. Isolation and manipulation
Promoters were sequenced by AuGCT Biotechnology (Beijing,
of recombinant DNA was performed using standard techniques
China). The sequence analysis was performed online with NCBI
[24]. All enzymes were from Promega China (Beijing, China) and
blast 2.0 ([Link]); promoter region was predicted by the
used as recommended by the manufacturer. The transformation of
BPROM program (Softberry Inc., Mount Kisco, NY, USA;
E. coli and B. subtilis was performed by electroporation [24], [25].
[Link]

Table 1. Plasmids used in this study.

Plasmids Relevant characteristics Sources

pGJ103 E. coli-B. subtilis shuttle vector [6]

pDL bgaB gene donor [6]
pDG1728 specR gene donor [27]
pShuttleF Promoter-trapping vector This study
pB43 P43promoter donor This study
pShuttle-09 Recombinant cloned promoter fragment This study
pShuttle-P43 pShuttleF inserted P43 Promoter This study
pShuttle-luxi bgaB directed by PluxS of B. licheniformis in shuttle vector This study
pShuttle-luxS bgaB directed by PluxS of B. subtilis in shuttle vector This study
pShuttle-luxP bgaB directed by PluxS of B. pumilus in shuttle vector This study
pShuttle-luxM bgaB directed by PluxS of B. megaterium in shuttle vector This study
pShuttle-Hyb bgaB directed by hybrid promoter from pShuttle-09 This study
pShuttle-Fus1 pShuttleF harbouring cloned promoter without of 59end of luxs CDS This study
pShuttle-PLapS pShuttle-F harbouring combined promoter PLapS This study
pShuttle-PLapP pShuttle-F harbouring combined promoter PLapP This study
pShuttle-PLapL pShuttle-F harbouring combined promoter PLapL This study
pShuttle-LapM pShuttleF -harbouring combined promoter PLapM This study
pLus-Hyb Expression vector based on PLapS This study
pLus-His Expression vector for expression purification This study
pLu-bga pLus-Hyb harbouring bgaB This study
pLuHis-bga pLus-His harbouring bgaB This study
pLu-bioI pLus-Hyb harbouring bioI This study
pLuHis-bioI pLus-His harbouring bioI This study

doi:10.1371/[Link].0056321.t001

PLOS ONE | [Link] 2 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

Table 2. Primers and oligonucleotides used in this study.

Primers Sequences (59R39) Restriction sites

bgaB-1 GCGGATCCATGAATGTGTTATCCTC BamH I

bgaB-2 TTGAGCTCCTCTA AACCTTCCCGG Sac I
spec-1 TTGGATCCGAATGGCGATTTTC BamH I
spec-2 TTGTCGACTTGAAAAAAGTGTTTCCAC Sal I
P43-1 TTGGGCCCTCAGCATTATTGAGTG Apa I
P43-2 TTGGATCCCATGTGTACATTCCTCTC BamH I
insert-1 TTGGATCCCACTTTATGGACGCC BamH I
insert-2 TTGGGCCCATTCGGATCGTCAC Apa I
luxS-up TTGGATCCACTCTCCCCTTTTTTAAAAATG BamH I
luxS-down TTGGGCCCTAATGTTTTTGTTTCTTTTC Apa I
luxP-up TTGGATCCATCAAGTTCAAAGCTTTC BamH I
luxP-down TTGGGCCCAAAAGTAAGTTATTTTTCC Apa I
luxM-up TTGGATCCCACTCCTTTTTTCTTCTTTC BamH I
luxM-down TTGGGCCCGTTTTACAGTCAAATAAG Apa I
luxL-down TTGGGCCCTTATTATAATATAAGC Apa I
bgaB-fus GGCGGGATCCTACGTAGGTACC BamH I
insert-3 TTGGATCCAGGTCAATGCTTTTC BamH I
lux-2 TTGGATCCTCTCTCCCCTCTAATCG BamH I
apr-1 TTGGGCCCTCAGGAGCATTTAAC Apa I
apr-2 CTCTATTTAGGTATATCATCTCTC
apr-3 TTGGGCCCTAAGAAAAATAGCATAC Apa I
apr-4 CTGTATATTCAGTTTAAGGGAAG
apr-5 TTGGGCCCTGCCAGGTTGAAG Apa I
apr-6 AAATAGAAGGATAATATAATCTATTCC
apr-7 TTGGGCCCAAAAATGGAAACAAAC Apa I
apr-8 GTAGACCCAATTTTTTTCAG
insert1-up TAGCGAGAGATGATACAAGAACGTCCTGATCTT
insert2-up TACTCTTATTTGCCTCAAGAACGTCCTGATCTT
insert3-up TATAATAAATTAACACAAGAACGTCCTGATCTT
insert4-up TAAAACAATCTGAAACAAGAACGTCCTGATCTT
apr1-down ATCAGGACGTTCTTGTATCATCTCTCGCTATTTC
apr3-down ATCAGGACGTTCTTGAGGCAAATAAGAGTAGACC
apr5-down ATCAGGACGTTCTTGTGTTAATTTATTATAGAA
apr7-down ATCAGGACGTTCTTGTTTTCAGATTGTTTTATTTC
laps-down TTGAATTCCTCTCTCCCCTCTAATCG EcoR I
Tag-1 CTAGACATCATCATCATCATCACAGCTAAATAAGAGCT
Tag-2 CTTATTTAGCTGTGATGATGATGATGATGT
bgaB-3 GCGGAATTCATGAATGTGTTATCCTC EcoR I
bgaB-T TTGGATCCAACCTTCCCGGCTTCATC BamH I
bioI-1 TTGAATTCGTGACAATTGCATCGTC EcoR I
bioI-2 TTGGATCCCACATTCTTAGGCTTATTC BamH I
bioI-3 TTTCTAGATTCAAAAGTCACCGGCAG Xba I

doi:10.1371/[Link].0056321.t002

Sub-cloning of promoter regions cloned from genomic DNA of B. subtilis 1A747, B. pumilus BYG
Using the primer pair P43-1/P43-2, the P43 promoter was and B. megaterium W-5, respectively. The corresponding amplicons
PCR amplified from plasmid pB43. The resultant promoter were then cloned into pShuttleF digested with Apa I and BamH I,
fragment was digested with Apa I and BamH I, and cloned into generating pShuttle-luxS, pShuttle-luxP and pShuttle-luxM. Using
corresponding sites of pShuttleF, resulting in pShuttle-P43. By insert-1/luxL-down as primers, the PluxS-i was amplified from
means of primer pairs luxS-up/luxS-down, luxP-up/luxP-down pShuttle-09 and cloned into pShuttleF, resulting in pShuttle-luxi.
and luxM-up/luxM-down, three luxS promoter fragments were The bgaB contained Shine–Dalgarno box (SD) was PCR amplified

PLOS ONE | [Link] 3 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

from pDL by using bgaB-fus and bgaB-2 and cloned into pshuttleF, independent experiments were performed with two replicates.
resulting in pDET-1. Then, the hybrid promoter amplified from Statistical tests were carried out by the SPSS (Statistical Product
pShuttle-09 (using the primer pair insert-3/insert-2) was cloned and Service Solutions) software. Data are presented as means6
into pDET-1 treated with Apa I and BamH I, resulting in S.D.
pShuttle-Hyb. By using the primer pair lux-2/insert-2, an isolated
promoter fragment (deletion of 59 coding region of luxS) was Results
amplified from pShuttle-09 and cloned into pShuttleF, yielding
pShuttle-Fus1. Screening and isolation of the strong promoter
fragments from B. licheniformis chromosomal DNA
Reconstruction of cloned promoter To screen and isolate strong promoter elements, a promoter
The reconstruction of promoter was carried out by the splicing trap vector pShuttleF (Figure 1A) was constructed on an E. coli-B.
by overlapping extension PCR. Four pairs of primers, apr-1/apr- subtilis shuttle vector pGJ103. The pShuttleF contained bgaB
2, apr-3/apr-4, apr-5/apr-6 and apr-7/apr-8, were employed to coding for a heat stable b-galactosidase (b-Gal) as a reporter gene.
PCR amplified 235 region of promoter Papr (promoter for the In addition, an alternative resistance selection marker, spectino-
alkaline protease gene) from genomic DNA of B. subtilis, B. pumilus, mycin, was introduced into the pShuttleF beside the chloram-
B. licheniformis and B. amyloliquefaciens, respectively, yielding PaprS-1, phenicol resistance marker. Both spectinomycin and chloram-
PaprP-1, PaprL-1 and PaprA-1. Four pairs of primers (insert1-up/Lux- phenicol resistance genes could confer the resistance selection
2, insert2-up/Lux-2, insert3-up/Lux-2 and insert4-up/Lux-2) either in E. coli or B. subtilis. Finally, an engineered BamH I
were used to amplify the PluxS and 210 region of the hybrid restriction site was designed next to the start codon of bgaB in
promoter from pShuttle-09. The upstream primers were designed order to clone DNA fragments digested by the Sau3A I. Validation
about 15 bp sequence homogenous with 39 end of PaprS-1, PaprP-1, of the pShuttleF was achieved by inserting a commonly used
PaprL-1 and PaprA-1, respectively, resulting in fragments luxF-1 to strong promoter P43 (2, 6) in B. subtilis upstream of bgaB. The
luxF-4. Other four pairs of primers (apr-1/apr1-down, apr-3/ resultant pShuttle-P43 was transformed into E. coli DH5a and B.
apr3-down, apr-5/apr5-down and apr-7/apr7-down) were em- subtilis 1A747 and blue colonies on solid LB plate supplemented
ployed to amplify promoters from PaprS-1, PaprP-1, PaprL-1 and with X-gal were isolated. The bgaB directed by the P43 in
PaprA-1respectively. The downstream primers were designed pShuttleF was duly expressed in E. coli and B. subtilis (Figures 1B
about 15 bp sequence homogenous with 59end of 210 region of and 1C).
the hybrid promoter, resulting fragment PaprS-2, PaprP-2, PaprL- In order to identify new promoters, Sau3A I-digested B.
2 and PaprA-2. With the mixture pairs of PaprS-2/luxF-2, PaprP-2/ licheniformis DNA fragments were inserted into the BamH I site of
luxF-3, PaprL-2/luxF-4 and PaprA-2/luxF-5 as templates, in which the promoter trap vector pShuttleF and resultant plasmids were
there were about 30 bp overlap in each mixture pair, four
electro-transformed into E. coli DH5a. Two hundred colonies were
overlapping PCR amplifications were facilitated by means of apr-
picked from about 1000 colonies according to visible coloration on
1/Lux-2, apr-3/Lux-2, apr-5/Lux-2 and apr-7/Lux-2, respective-
the X-gal screen plate in the presence of both antibiotics. The b-
ly. Recombined promoters PLapS, PLapP, PLapL and PLapA were
Gal activities by these recombinants after 24 h of culture ranged
digested with Apa I and BamH I and cloned into pShuttleF,
from 500 Miller U/mL to 14016 Miller U/mL. Amongst them,
respectively, resulting in pShuttle-PLapS, pShuttle-PLapP, pShuttle-
the recombinant pShuttle-09 demonstrated the highest b-Gal
PLapL and pShuttle-PLapA.
production. The selected 200 colonies were also electro-trans-
formed into the B. subtilis1A747. Ten blue colonies were selected
Construction of expression vectors to measure the b-Gal activities. As shown in Figure 1C, pShuttle-
Using primers apr-1 and laps-down, the promoter PLapS flanked
09 again showed the highest b-Gal activity with the activity of
by Apa I and EcoR I was PCR amplified from pShuttle-PLapS. The
164176300 Miller U/mL at 24 h, which was eight times of that
resultant promoter was digested with Apa I and EcoR I and cloned
from the P43 promoter system in B. subtilis. To further verify the
into corresponding sites of pGJ103, yielding the expression vector
reporter gene product driven by pShuttle-09, SDS-PAGE analysis
pLus-Hyb. To introduce 6-His tag, synthetic oligonucleotides Tag-
of the b-Gal from the pShuttle-09 both in E. coli and B. subtilis was
1 and Tag-2 were annealed. The annealed fragment with adhesive
carried out. Coomassie blue staining revealed a distinct band with
ends of Xba I and Sac I at 59 and 39 ends respectively was inserted
a molecular mass of approximately 70 kDa, which corresponded
into the Xba I-Sac I-treated pLus-Hyb, resulting in pLus-His.
to the molecular weight of b-Gal (data not shown). Taken
Using primer pairs bgaB-3/bgaB-2 and bgaB-3/bgaB-T, two
bgaB fragments were PCR amplified from pShuttleF, resulting in together, these results suggested that pShuttle-09 contained a
bgaF-1 flanked with EcoR I and Sac I and bgaF-2 with EcoR I putative strong promoter from B. licheniformis chromosomal DNA
and BamH I. bgaF-2 did not contain the termination codon. The and drove expression of the reporter gene both in E. coli and B.
bgaF-1 and bgaF-2 were cloned into pLus-Hyb and pLus-His, subtilis.
respectively, yielding pLu-bga and pLuHis-bga. Similarly, the bioI
gene were PCR amplified from B. subtilis 1A747 genomic DNA by Sequence analysis, predication and characterization of
using primer pairs bioI-1/bioI-2 and bioI-1/bioI-3, resulting in the cloned promoter fragment
bioIF-1 with EcoR I and BamH I and bioIF-2 with EcoR I and To characterize the putative promoter DNA element in
Xba I. The resultant fragments were inserted into pLus-Hyb and pShuttle-09, the inserted fragment was enzyme cut and sequenced.
pLus-His, yielding pLu-bioI and pLuHis-bioI. The sequencing result showed that the inserted fragment was
305 bp long. Sequence alignment showed that the inserted
b-Gal activity assay sequence in pShuttle-09 belonged to B. licheniformis genome
The b-Gal activity assay was carried out as previously described sequence (NC_CP000002.3) with 96% of homology. According
[27]. Samples were taken at different time points of culture and the to the annotation of B. licheniformis genomic DNA sequences, the
b-Gal activity was measured. The activity was expressed as Miller inserted sequence contained two fragments (Figure 2A) corre-
units per mL sample (Miller U/mL). For each assay, three sponding to a partial sequence of the coding region of ylyB gene

PLOS ONE | [Link] 4 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

Figure 1. A map of the promoter trap vector pShuttleF (A) and b-Gal activities of 10 selective positive clones in E. coli (B) and B.
subtilis (C). (A) The rep represents the replication protein in B. subtilis. ColEI, bgaB and Cm represent the E. coli ColEI replicon, the coding sequence of
b-Gal and chloramphenicol-resistance marker, respectively. The unique restriction sites are marked on the outside of the map. (B). Production of b-Gal
from 10 selective positive clones in E. coli DH5a after 24 h culture. Different letters on columns indicate significant differences (p,0.05). (C).
Production of b-Gal from 10 selective positive clones in B. subtilis 1A747 after 24 h culture. Different letters on columns indicate significant differences
(p,0.05).
doi:10.1371/[Link].0056321.g001

(about 109 bp) and a 59end partial sequences of luxS (about 09. However, further in silico prediction of promoters (Figure 2B)
200 bp). indicated two conserved prokaryotic promoter regions with high
Sequence analyses (Figure 2B) also showed truncated luxS gene probability scores in the cloned fragment. The first putative
was fused with bgaB and a typical SD was present 7 bp upstream of promoter (PluxS) was located in the 59 non-translational region of
the start codon of the luxS gene. It contained typical 235 and 210 luxS gene. Interestingly, the second putative promoter was located
elements recognized by a Sigma Factor sA. Therefore, the on two sides of the second Sau3A I-cutting site in pShuttle-09. The
promoter PluxS might be the control element of bgaB in pShuttle- 235 element was located within the coding region of ylyB, while

Figure 2. A map (A) and the sequence (B) of an inserted fragment in pShuttle-09. (A) ylyb CDS is the coding sequence of ylyb; luxS CDS
represents the coding sequence of luxS; Partial luxS includes 59 non-translated region and an 87 bp coding sequence of luxS. (B) The conservative
regions of two putative promoter (210 and 235) are underlined. The Sau3AI restriction sites are indicated. The beginnings of open reading frames of
luxS and bgaB under the putative promoters are indicated by arrows.
doi:10.1371/[Link].0056321.g002

PLOS ONE | [Link] 5 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

the 210 element was located upstream of the core promoter Construction of expression vector using the improved
region of luxS. promoter PLapS
In order to determine the effect of the first putative promoter To further exploit its application in B. subtilis, the strong
(PluxS) on the reporter gene expression, a PluxS-i vector was promoter PLapS was sub-cloned as a truncated fragment flanked
constructed by sub-cloning a 200 bp PluxS fragment into pShuttleF. with engineered Apa I and EcoR I restriction sites, with the EcoR
For facilitating a rigorous comparison, promoters of luxS were also I site close to the SD. The resultant promoter was assembled to E.
cloned from genomic DNA of B. subtilis, B. pumilus and B. coli-B. subtilis shuttle vector pGJ103, generating an expression
megaterium. The b-Gal production driven by PluxS from B. subtilis, B. vector pLus-Hyb (Figure 4A). In order to easily detect and purify
pumilus and B. megaterium were about 78%, 63% and 70% of that expressed protein, another vector pLus-His (Figure 4B) was
from B. licheniformis (Figure 3A), respectively. However, the b-Gal constructed through introducing 6-his tag at the end of MCS in
production driven by PluxS from B. licheniformis was only about 27% pLus-Hyb.
of that from pShuttle-09 in B. subtilis (Figure 3A). These data To determine efficiencies of pLus-Hyb and pLus-His, bgaF-1
strongly suggested that PluxS is not a major promoter for b-Gal and bgaF-2 were cloned into pLus-Hyb and pLus-His, respective-
expression in pShuttle-09. ly, to facilitate b-Gal expression. The production of b-Gal from the
Analysis of the second putative promoter showed the 210 pLu-bga reached 2603761037 Miller U/mL (Figure 4C), indi-
region was located at 6 bp in the second Sau3A I-cutting region cating that the b-Gal was highly expressed. SDS-PAGE analyses of
and 235 region was located at 86 bp in the first Sau3A I-cutting b-Gal from crude extract of B. subtilis harbouring pLu-bga
region in pShuttle-09. A partial sequence of the coding sequence (Figure 4D) or purified b-Gal from B. subtilis harbouring
of the ylyB gene by itself could not have the promoter activity, since pLuHis-bga (Figure 4E) further verified that b-Gal was successfully
it did not contain complete promoter elements. It appears that the expressed. Similarly, bioI gene involved in biotin biosynthesis
hybrid promoter was unintentionally created in pShuttle-09. pathway of B. subtilis was successfully expressed by using two
Subsequently, this hybrid promoter was sub-cloned to determine similar expression vectors (pLu-biol and pLuHis-biol) in B. subtilis
whether it can direct the expression of b-Gal or not. As shown in (Figure 5). Therefore, these results further demonstrated the
Figure 3B, the b-Gal production driven by the hybrid promoter effectiveness of the promoter systems for protein expression.
was about 67% of that from pShuttle-09 in B. subtilis. It seems that
both the hybrid promoter and PluxS contributed additively to
Discussion
expression of b-Gal in pShuttle-09.
The major finding from this study is that an artificial double
Improvement of the cloned double promoter through promoter was obtained from B. licheniformis through a promoter
reconstruction of the hybrid promoter element trap system. The double promoter contained PluxS and a hybrid
In order to further improve efficacy of the double promoter, the promoter and can be used for protein expression in B. subtilis.
second Sau3A I-cutting region containing PluxS and another 210 These results support the notion that it is possible to shuffle,
region was assembled with 235 regions of PApr from B. subtilis, B. generate and select a strong prokaryotic promoter simultaneously,
pumilus, B. licheniformis and B. amyloliquefaciens, respectively. The by applying a promoter trap system to randomly cut DNA
corresponding promoters, PLapS, PLapP, PLapL and PLapA, were used fragments from a genome.
to drive the expression of b-Gal. The results (Figure 3C) indicated The interest in promoters stems from myriad opportunities for
that b-Gal activity driven by PLapS was 1.6 fold higher than that controlling gene expression. Our promoter trap system was
from pShuttle-09 after 24 h culture. On the other hand, the designed to increase the stringency of screening by employing
production of b-Gal from PLapA, PLapP and PLapL was only about the coding region of bgaB rather than the bgaB gene with a SD as a
81%, 32% and 33% of that from pShuttle-09, respectively. reporter. So far, the promoter-less bgaB gene has been used as a
Subsequently, PLapS was used for construction of expression reporter in several promoter trap systems [11], [22]. However,
vectors. others usually used bgaB gene with a SD. In our system, promoter
fragments inserted into the upstream of bgaB could not drive

Figure 3. b-Gal activities from PluxS (A), the hybrid promoter (B) and the reconstructed promoters (C). (A) Production of b-Gal from
pShuttle-09, pShuttle-luxi, pShuttle-luxS, pShuttle-luxP and pShuttle-luxM in B. subtilis 1A747 after 24 h culture. Different letters on columns indicate
significant differences (p,0.05). (B) Production of b-Gal from pShuttle-Hyb (gray columns) and pShuttle-Fus1 (black columns) in B. subtilis 1A747 after
different hours of culture. Different letters on columns in the same time point indicate significant differences (p,0.05). (C) Production of b-Gal from
pShuttle-Fus1, pDE-PLapS, pDE-PLapP, pDE-PLapL and pDE-PLapA in B. subtilis 1A747 after 24 h culture. Different letters on columns indicate significant
differences (p,0.05).
doi:10.1371/[Link].0056321.g003

PLOS ONE | [Link] 6 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

Figure 4. Maps of expression vectors pLus-Hyb (A), pLus-His (B), the b-Gal activity from the pLu-bga (C), SDS-PAGE analyses of
BgaB in crude extract (D) or after purification (E). (A) ORI+, ORI2 and rep represent the single-strand replication origin, the double strand
origin and the replication protein in B. subtilis, respectively. ColEI and Cm represent the E. coli ColEI replicon and a chloramphenicol-resistance marker.
The unique restriction sites are marked on the outside of the map. PLapS represent the improved promoter. (B) His Tag represents the 6 histidine tag.
(C) Production of b-Gal from pShuttle-Fus1 (e) and pLu-bga (¤) in B. subtilis 1A747, respectively. (D) Lane 1, molecular mass markers (top to bottom:
116, 66, 45, 35 and 25 kDa); Lanes 2, 3 and 4, crude extract of three replicate cultures of B. subtilis 1A747 harbouring pLu-bga harvested at 24 h; lane
5, crude extract of B. subtilis 1A747 harbouring pLus-Hyb as a negative control. (E) Lanes 1 and 2, purified b-Gal from B. subtilis 1A747 harbouring
pLuHis-bga; Lane 3, molecular mass markers (top to bottom: 116, 66, 45, 35 and 25 kDa).
doi:10.1371/[Link].0056321.g004

expression of b-Gal unless the cloned promoter fragments contain coding sequence of ylyB gene and a 210 element from non-coding
SD. This design might limit the number of recombinant clones sequence of luxS gene. Our hybrid promoter is artificially created
which can be screened. Nevertheless, approximately 1000 blue and quite different from reported hybrid promoters, which contain
recombinant colonies were observed in this study. The strength of elements from two different promoters. It is well known that a
cloned promoters was conveniently determined via coloration hybrid promoter could be far more efficient than either one of the
caused by production of b-Gal when a recombinant harbouring a parental promoters [29]. Recently, Kim [30] constructed a hybrid
promoter fragment was cultured on solid LB supplemented with promoter, BJ27UP, from a strong promoter BJ27D88 and a
X-gal. Further quantitative determination of putative promoter fragment of the tac promoter in order to express B. licheniformis
strength was easily achieved by measuring the activity of b-Gal. aminopeptidase in B. subtilis and found that the activity of the
B. licheniformis genomic DNA was used as a potential promoter hybrid promoter was increased approximately threefold in
source in this study. Recombinant protein expression in B. subtilis comparison with the tac promoter. Nevertheless, the study on
can be driven by promoters from B. subtilis or from other bacillus hybrid promoters is limited, presumably due to lack of suitable
species. To date, several strong exogenous promoters for the B. ways to create hybrid promoters.
subtilis system have been isolated and used to construct expression The results from this study also demonstrated the capability of a
vectors [3], [12], [28]. For example, exogenous promoters Pxyl and promoter trap system to create a double promoter. Interestingly,
Pspac have been widely used as expression control elements in B. both the hybrid promoter and PluxS promoter in our study
subtilis [12], [28]. Our results support the notion that other bacillus contributed to transcription of the reporter gene in an additive
species could be good sources of strong promoters for B. subtilis. way. A double promoter in this study is defined as the combination
Our results exemplified the potential of a promoter trap system of two promoters which control transcription of same gene. This
to create a strong hybrid promoter. A hybrid promoter is defined definition is different from most overlapping promoters often seen
in this study as a promoter consisting of different core elements in bacteria. Analyzing the database of the E. coli genome, Bendtsen
from two different genes. One promoter identified in this study is a [31] found 14% of the identified ‘forward’ promoters overlap with
hybrid promoter assembled artificially from a 235 region from the a promoter oriented in the opposite direction. These overlapping

PLOS ONE | [Link] 7 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

growth and sporulation may be regulated by tandem overlapping

promoters whose transcription initiation points are either identical
or very close. The possible benefit of double promoters to increase
transcription has been explored in biotechnological application.
Most studies have showed that two or more tandem promoters
could significantly improve the expression level of heterogeneous
genes. Widner [33] found that gene expression was distinctly
increased under the control of two or three tandem promoters in
contrast to one alone in B. subtilis. Kang [34] also reported that
two expression systems constructed by sequential alignment of a
constitutive promoter for either a-amylase from B. subtilis NA64 or
maltogenic amylase from B. licheniformis downstream of the Hpa II
promoter elevated the TSaGT productivity by 11- and 12-fold,
respectively, in comparison with the single Hpa II promoter
system. Li [35] tried to construct multiple core-tac-promoters
(MCPtacs) in tandem and found that integration of the phaCAB
Figure 5. Wavelength scan analysis of Biol production from B.
genes with the 5 copies of core-tac-promoters resulted in an
subtilis1A747 harbouring pLu-bioI (A) and SDS-PAGE analyses
of Biol production from crude extract or purified Biol of B. engineered E. coli that can accumulate 23.7% polyhydroxybuty-
subtilis1A747 harbouring pLu-bioI and pLuHis-bioI, respective- rate of the cell dry weight in batch cultivation. On the other hand,
ly (B). (A) The arrow indicating the characteristic absorption peak of Wu [36] did not observe improvement of expression, when two
BioI. (B) Lane 1, crude extract of B. subtilis 1A747 harbouring pLus-Hyb tandem-linked promoters were used. Our results support the idea
as a negative control; Lane 2, crude extract of B. subtilis 1A747 to use double promoters to increase production efficiency of
harbouring pLu-bioI; Lane 3, molecular mass markers (top to bottom:
116, 66, 45, 35 25 and 18 kDa); Lanes 4 and 5, purified b-Gal from B.
recombinant proteins. Whether the double promoter in this study
subtilis 1A747 harbouring pLuHis-bioI. is targeted by same RNA polymerase or different RNA
doi:10.1371/[Link].0056321.g005 polymerases is not known at this time and worthy of further
investigation.
promoters are arranged in three different ways: (i) each promoter In conclusion, our data support the concept of using a promoter
transcribes a gene and one or more regulatory proteins are trap system to discover new promoters. The usefulness of a
identified which affect transcription of at least one of the promoter trap system is likely due to random shuffling and
promoters directly; (ii) each promoter transcribes a gene but no recombination of DNA fragments and adoption of a rapid and
regulatory proteins are known to bind the promoter region; and high-throughput screening. It is tempting to speculate that more
(iii) only one of the promoters transcribe an annotated gene, while novel promoters could be found if reaction conditions for cutting
the other promoter could transcribe a regulatory antisense RNA and ligation could be adjusted to increase chances for shuffling
or act as a regulatory RNAP binding site which interferes with the DNA fragments.
promoter transcribing the annotated gene [31]. However, some
overlapping promoters do control same gene. For example, Wang Author Contributions
and Doi [32] detected two overlapping promoters for the Conceived and designed the experiments: XZ YC MY. Performed the
chloramphenicol acetyltransferase gene and these two promoters experiments: MY WZ SJ PC. Analyzed the data: MY XZ YC. Contributed
were recognized by two different RNA polymerase holoenzymes. reagents/materials/analysis tools: MY WZ SJ. Wrote the paper: XZ YC
The authors further proposed that genes expressed during both MY.

References
1. Schallmey M, Singh A, Ward OP. (2004) Developments in the use of Bacillus 10. Li W, Li HX, Ji SY, Li S, Yang MM, et al. (2007) Characterization of two
species for industrial production. Can J Microbiol 50:1–17. temperature-inducible promoters newly isolated from B. subtilis. Biochem
2. Zhang XZ, Cui ZL, Hong Q, Li SP. (2005) High-level expression and secretion Biophys Res Commun 358:1148–1153.
of methyl parathion hydrolase in Bacillus subtilis WB800. Appl Environ Microbiol 11. Phan TT, Nguyen HD, Schumann W. (2012) Development of a strong
71: 4101–4103. intracellular expression system for Bacillus subtilis by optimizing promoter
3. Schumann W. (2007) Production of recombinant proteins in Bacillus subtilis. Adv elements. J Biotechnol 157: 167–72.
Appl Microbiol: 62:137–189. 12. Bhavsar AP, Zhao XM, Brown ED. (2001) Development and characterization of
4. Nguyen HD, Schumann W. (2006) Novel plasmid-based expression vectors for a xylose-dependent system for cloned gene in Bacillus subtilis: conditional
intra- and extracellular production of recombinant proteins in Bacillus subtilis. complementation of a Teichoic acid mutant. Appl Environ Microbiol 67: 403–
Prot Expr Purif 46:189–195. 410.
5. Lee SJ, Pan JG, Park SH, Choi SK. (2010) Development of a stationary phase- 13. Heravi KM, Wenzel M, Altenbuchner Josef. (2011) Regulation of mtl operon
specific autoinducible expression system in Bacillus subtilis. J Biotechnol 149:16– promoter of Bacillus subtilis: requirements of its use in expression vectors. Microb
20. Cell Fact 10:83.
6. Yang MM, Zhang WW, Zhang XF, Cen PL. (2006) Construction and 14. Yang MM, Zhang WW, Chen YL, Gong YS. (2010) Development of a Bacillus
characterization of a novel maltose inducible expression vector in Bacillus subtilis expression system using the improved Pglv promoter. Microb Cell Fact
subtilis. Biotechnol Lett 28:1713–1718. 9:55.
7. Zhu FM, Ji SY, Zhang WW, Li W, Cao BY, et al. (2008) Development and 15. Sun T, Altenbuchner J. (2010) Characterization of a mannose utilization system
Application of a Novel Signal Peptide Probe Vector with PGA as Reporter in in Bacillus subtilis. J Bacteriol 192: 2128–2139.
Bacillus subtilis WB700: Twenty-Four Tat Pathway Signal Peptides from Bacillus 16. Rhodius VA, Mutalik VK. (2010) Predicting strength and function for promoters
subtilis were monitored. Mol Biotechnol 39: 225–230. of the Escherichia coli alternative sigma factor, sigmaE. Proc Nat Acad Sci 107:
8. Meijer WJJ, Salas M. (2004) Relevance of UP elements for three strong Bacillus 2854–2859.
subtilis phage phi29 promoters. Nucleic Acids Res 32:1166–1176. 17. Kaltwasser M, Wiegert T, Schumann W. (2002) Construction and Application
9. Zhang AL, Liu H, Yang MM, Gong YS, Chen H. (2007) Assay and of Epitope- and Green Fluorescent Protein-Tagging Integration Vectors for
characterization of a strong promoter element from B. subtilis. Biochem Biophys Bacillus subtilis. Appl Environ Microbiol 68: 2624–2628.
Res Commun 354: 90–95. 18. Gat O, Inbar I, Aloni-Grinstein R, Zahavy E, Kronman C, et al. (2003) Use of a
Promoter Trap System in Bacillus anthracis and Bacillus subtilis for the

PLOS ONE | [Link] 8 February 2013 | Volume 8 | Issue 2 | e56321

 A Artificial Double Promoter in Bacillus subtilis

Development of Recombinant Protective Antigen-Based Vaccines. Infect 28. Hartl B, Wehrl W, Wiegert T, Homuth G, Schumann W. (2001) Development
Immun 71: 801–813. of a new integration site within the Bacillus subtilis chromosome and construction
19. Cui ZL, Zhang XZ, Zhang ZH, Li SP. (2004) Construction and application of a of compatible expression cassettes. J Bacteriol 183: 2696–2699.
promoter-trapping vector with methyl parathion hydrolase gene mpd as the 29. de Boer HA, Comstock LJ, Vasser M. (1983) The tac promoter: a functional
reporter. Biotechnol Lett 26: 1115–1118. hybrid derived from the trp and lac promoters. Proc Nat Acad Sci 80: 21–25.
20. Aoki S, Kondo T, Ishiura M. (2002) A promoter-trap vector for clock-controlled 30. Kim JH, Lee BR, Lee YP. (2011) Secretory overproduction of the
genes in the cyanobacterium Synechocystis sp. PCC 6803. J Microbiol Methods 49: aminopeptidase from Bacillus licheniformis by a novel hybrid promoter in Bacillus
265–274. subtilis. World J Microbiol Biotechnol 27: 2747–2751.
21. James AC, Philip ES, Patricia R, Abdallah FE, Claude FG. (2003) An enhanced 31. Bendtsen KM, Erdossy J, Csiszovszki Z, Svenningsen SL, Sneppen K, et al.
GFP reporter system to monitor gene expression in Borrelia burgdorferi. (2011) Direct and indirect effects in the regulation of overlapping promoters.
Microbiol 149: 1819–1828. Nucleic Acids Res 39: 6879–6885.
22. Phan TT, Nguyen HD, Schumann W. (2010) Establishment of a simple and 32. Wang PZ, Doi RH. (1984) Overlapping promoters transcribed by Bacillus subtilis
rapid method to screen for strong promoters in Bacillus subtilis. Prot Expr Purif sigma 55 and sigma 37 RNA polymerase holoenzymes during growth and
71: 174–178.
stationary phases. J Biol Chem 259: 8619–8625.
23. Wang YG, Xia QY, Gu WL, Sun JB, Zhang H, et al. (2011) Isolation of a strong
33. Widner B, Thomas M, Sternberg D, Lammon D, Behr R, et al. (2000)
promoter fragment from endophytic Enterobacter cloacae and verification of its
Development of marker-free strains of Bacillus subtilis capable of secreting high
promoter activity when its host strain colonizes banana plants. Appl Microbiol
levels of industrial enzymes. J Ind Microbiol Biotechnol 25: 204–212.
Biotechnol 93: 1585–1599.
24. Maniatis T, Fritsch EF, Sambrook J. (1982) Molecular Cloning: A Laboratory 34. Kang HK, Jang JH, Shim JH, Park JT, Kim YW, et al. (2010) Efficient
Manual. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY constitutive expression of thermostable 4-a-glucanotransferase in Bacillus subtilis
25. Yang MM, Zhang WW, Bai XT, Li HX, Cen PL. (2010) Electroporation is a using dual promoters. World J Microbiol Biotechnol 26: 1915–1918.
feasible method to introduce circularized or linearized DNA into B. subtilis 35. Li MJ, Wang JS, Geng YP, Li YK, Wang Q, et al. (2012) A strategy of gene
chromosome. Mol Biol Rep 37: 2207–2213. overexpression based on tandem repetitive promoters in Escherichia coli. Microb
26. Guerot-Fleury AM, Frandsen N, Stragier P. (1996) Plasmids for ectopic Cell Fact 11:19.
integration in Bacillus subtilis. Gene 180: 57–61. 36. Wu SM, Feng C, Zhong J, Huan LD. (2011) Enhanced production of
27. Hirata H, Fukazawa T, Negoro S, Okada H. (1986) Structure of a b- recombinant nattokinase in Bacillus subtilis by promoter optimization.
galactosidase gene of Bacillus stearothermophilus. J Bacteriol 166: 722–727. World J Microbiol Biotechnol 27: 99–106.

PLOS ONE | [Link] 9 February 2013 | Volume 8 | Issue 2 | e56321