Evolution

Airds
Nonocots Herbs Shrubs Trees
Mammals

Roptites
Dicots
Amphibia
Fish Flowering plants Conters

Insects Mosses

Ferns
Anelids
Crustacea Liverworts

Mollusc
Flatworms
Algae
Coelenterates Fungi
4
Multicellular Multiceluar
animals
plants
Single celled
organisms

Evolution
The word evolution has been derived from Latin
Word 'Evolvere' which means unrollor unfold in
the development of something by slow natural
process from rudimentary to more highly
original condition. Evolution is the gradual
change or development of something through
natural process over the time. Xsk
Evolution can be defined as the gradual change
which is going on very slowly throughout the
millions of years which can only be imagined.
The word 'evolution' was first used by French
Scientist Jean Baptiste de Lamarck.
 Evidences of Evolution k

" Fossil Evidence

Comparative Anatomy
Homologous Structures
bAnalogous Structures
VestigialOrgans and Structures
Embryology
" Similar Genes

Evidence: FossilRecord

wpereor
on Ca

4500 4000 3500 3000 2500 2000 1500 1000

mdlioge o ye

origins bacteria complex cells dinosaurs humans

The fossil record shows a sequence from simple bacteria to more
complicated organisms through time and provides the most compeling
evidence forevolution.
 Anchaapiong
. 4hoy
is he niml 6/4/2016 -h

oot bind and raphle

FossilEvidence
elann eaiie,.
claws
wing-ike
forelimbs evi denee f evolua
bindy
may be e volved
teeth
thin -fhe esp hle milisn
ribs

long tail.

feathers
Replica of Archaeop teryx fossil; Reptile-like features
half bird half reptile
Bird-like features

Comparative Anatomy Lilomologous structure are struchures

Homologous Structures that sharea commonorigin but may
serve different functions in moden
Analogous Structures species.
-Vestigial Organsand These structures are evidence that
Structures organisms with similar structure
evolved from a common ancestor.
Examples includeltheforclimbs ofa
variety of mammas Forexample,
human, cat, whale and bat.)
HHomologous Sruetures
MumAn ird Porpolse tleph ant
 Analogous structures
Arelogougsrwtune
Analogous structures are a contrast to ir

homologous structures.
They serve the same function between organisms
but are different in internal anatomy. |
Buch as thelwings of birds and butterfliesjor the
eyes of lobsters and fish.
Anlogos
Sructuees

Vestigial organs e
yestigial organs proy further evidence for evolutionary change.
usually dwarfed and uselesstothe organism.
Examples of these include:
The human appendix which is useless in humans but in other mammals it is
necessary for digestionof high cellulose diet.
The human extrnal ear muscles.
The tail bone.
Wisdom teeth.
Some snakes have skeletal limbs.
Sometimes vestigial organs may be adapted for new uses
e.g. penguin wings can't be used for flight ,yet they are adapted for swimming.
Even though organisms have these organs there is no significant diadvantage to the organis

Har

Skir1

SetaceaUs
iiland
Amector ptli
MAcle
 Embryology
"Inthe early stages of development embryos of many
extremely similar.) organisms look
Embryos in mammals, birds, reptiles and fish have many body
in common.
e.g. Gillslits, two chambered heart, and tail. similarities
As the embryos develop further, the
similarities gradually disappear.
This embryonic resemblances indicated that organisms are related by
common ancestors.) their

tiotocto d

Fish Bird Repte Humen

Snake Chicken Possum Cat Bat Human

Phanges
ouches
Eaty

hóde
fale

Late

orm
 Similar Genes

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE cCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA cCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

"Ifevolution is true then we might also expect that closely

related organisms will be more similar to one another than more
distantly related organisms.
Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearty genetically identical
(differ by less than 1.2%) whereas the mouse differs by =15%.

Theories of evaluation:
There are three main theories of evaluation (i) Theory of inheritance of acquired
Modern
character (Lamarkism) (ii) Theory of natural selection (Darwinism) and (ii)
synthetic theory on Neo-Darwinism.
of inheritance of
The Theory of inheritance of acquired character: The Theory
Lamark in 1801 and was
acquired characters was outlined by French scientist J.B.
adaptation to
published in 1809. Modifications which the organism acquires in handed
are automatically
the environments which it meets during its life time
The theory is known as
down toits descendants, and so become part of heredity.
larnarkism and can be summarized in four laws:
component parts
(1) Nature tends to increase the size of living organisms and their the
of anew need felt by
(2) Production ofa neworgan in the body is the result
organisms.
disuse causes its
(3) Constant use of an organ results in its better development while
reduction and degeneration.
its
(4) Characters acquired by the individual during its life time are inherited by
offspring's.
 Example:
To explain the theory whic1 was based on the ideas, direct environmental effects over
living organisms, use and Jisuse and the inheritance of acquíred trails. Lamark used
examples like long neck ulgiralle limblesness in snakes, webbed feet of ducks,
Bindness of moles and also demorphism of submerged and aerial leaves in
aquatic plants.
He explained the evolution ofthe girafe as follovw:
An original deer-like animal finding the supply of grass and herbs inadequate started
to feed on the leaves of trees Ttneeded greater heightto reach the higher leaves and
the process of reaching. its neck become longer and longer. In the course of
generations the longer neck become heightened and modern giraffe is the result of
evolution.

Similarly, the lizards who crawled on the ground through the grass, gradually lost
their limbs and become modified into snakes.

Eohippus
40 milion years ago

30 milion years ago

15 million yars ago

PIlonipgu
10 mlion yars ago

(modern horse)

Fig 5.3.6 Fossils provide an aXcell ent record of the evolutlonary

development of the horse. Evolution has caused some toes on the horse
to shorten unt! hey eventually disappeared. Other toes tormed a hoof.
 Significance of Lamarkism:
Lamarkism theory was simple and it had some appeal, as it provided away in
which change in organisn couldcome about.

hwas the first completely comprehensive mechanistic theory that was

offered
It was the theory that lent itself to prediction and therefore, to testing,

It was exemplified by many common examples. Most persons know that

exercise results in longer muscles deep sea fishes have udimentary eyes,
carnivorous animals p0Sses clawand ventral side of body posses sensitive skin
and tactile points.
structure.
5)) The theory also offered a means of explaining reduced or vestigial

Furthermore, through disuse the eyes of a cave animal might become

functionlesS and might even disappear.

Criticism or Limitations of LamarkTheory:

While
The frst preposition of Lamarksuggests the tendency to increase in size.
with
the evolutionary trend in a certain groups of organisms may be associated
not only
increase of size, there are many cases, where evolution proceeded
size.
without any increase in size but rather through a reduction in

new need, is quite

The second lamarkian principle, that new organs result from environment acted
manifestly false. Jin case of animal he believed that the
desire of the animal leads to the
through the nervous system; in other words the
would mean that the man
formation of new [Link] its crudest form this
have sprontel wings and taken
who mused "Birds can fly, so why can't I? Should
to the airt
due to use and
The third lamarckian principle that organs will develop
an organ within the
degenerated due to disuse may be correct as far as growth of
lifetime of an individual is concerned.
 L The fourth and final preposition of Bamarck was that the inheritance of characters
acquired during the lifetime of the individual. This principles was studied by many
scientist and reported as follow:
n1890, August Weismann studied by cuting the tails of white mice for morethan.
20 generations to see if this has any efect on tail length. The measuring of tail
length of the offspring of 20 successive generations revealed that on average the
tail were not shorter. it means that acquired characters were not inherited.

(ii) Castle and Phillips perforrmed and experiment by transplanting the ovary of a
black female guinea pig into the body of while female guinea pig and recipient
female was mated with a male guinea pig. They found that all the individuais from
this pair were black. This shown that the environment does not affect the hered1ty
as has been suggested by Lamarck.
üi Boaring of ears and nostrils in Indian women has been continued as the tradition
from centuries but their offspring's do not show any trace of hole in cars and
nostrils.
(iv)The Chinese bound the feet of their women for many generations, yet this has not
resulted in any modification of the feet of present day Chinese women.

v)iewish and Muslim boys have been circumcised for thousands of years but this has
not resulted in a tendency towards the reduction of the prepuce in them.

2) Theory of natural selection (Darwinism) X

Both Charles Darwin and Wallace put forward their views independently in 1885.
A year latter Darwin published his book The origin of Species' and put forward
the hypothesis that natural selection is the essential factor in evolution.

TAccording to Darwin, Nature selects such animals and plants which posess
'most suitable characters for a particular environment while the less suitable
are eliminated) The theory may be generalized as follows: "the change in species
by the survival of an organismal type exhibiting a natural variation that gives it
adaptive advantages in an environment thus leading to a new environmental
equilibrium is evolution by natural selection". The theory is based on the
foilowing elements.

1. The universal occurrence of variation:Varialion is the characteristic of every

group of animals by which organisms differ each other. Darwin believed that
these variations (useful or un-useful) are heritable and are passed on to the
offspring.
 of
species,
[Link] (over prodection): Every manner
2. An ercessive natural rate
tends to increase in a geometrical
in the absence of environmental checks,animals exceed thousands or even a million.
The number of eggs produced by some flies will produce on an average 19 x
h has been calculated that one pair of house
slowest breeder amount mammals in
10offspring's in one season. Elephant is the of 800 years.
absence of any cheeks have 29 million offspring's at the end
3. Struggle for existence: Since more individuals are born than they can survive,
struggle for survival, a
there is a intraspecific or interspecific or environmental active kill or killed
competition for food, mates and space. This contest may be an
strugle.
4. Survival of the fittest: In the struggle for
existence, all do not succeed and
individual
majority of the individuals perish and fail to reproduce. Only those
having inherited variations such as favourable structure and physiology are adopted
This idea of "the survival of the
and survive others are handicaps and eliminated.
fittest" is the core of the theory of the natural selection.
the next generation
S. Natural selection: The surviving individuals willgive rise to
will be transmitted to the
and favorable variations which made them success
Thus Darwin
succeeding generations for further modification and adaptation.
in
believed that the new species will always be better adapted to the environment
which animals are living.

The Origin of Species makes thisargument,

structured logically..
possibly
-Al organisms produce more offspringthancan
Survive
- Al organisms vary for a wide variet of diferent
attributes and features-théy also vatyinreproductive
sUCcess:some have more ofispringhan others.
- Some variation is heritable.
- Some of this variation must influenGereproductive
SUCcesS
characteristics
- Given that the above are true...desirable
will thus be preferentially pased Ita
to oifspring
"Thisis a logicalconcluslon of the first foür points
Darwin concluded, based upon Intuitive grounds, that, over
vast spans of time, present day speciog have descended
from acommonancestor. The bookcontained no
mechanlsmfor speciatlon, however.
 Evolutioi of Elephant:
Hyracoldea
(Hynxe)
Sirenia
(Manatees
and rotatvea)
Moeritheru
tBenytherm N
toeinetherum
tMummut
fplatybelodon
t stegodon

Mammuthus
Elephas merlmus
(Asla)
Loxodonta sfricana
(Africa)
Loxodonta cycloths
(Atrica)
60 3 SS 2100

MIlions of yenrs ago Yers ago

Evolutionary Trends of Elephant:

The elephant Elephas maximus belongs to order proboseidea of class Mammalian.

tn
They characterized by the presence of proboscis, huge body, pillar-like limbs, short
neck and the- Itis the modification of upper jaw.
Living elephants have one pair of tusks which is modified second upper-incisors and
onone complete or two partial grinders in each, half jaw. of a
Molars are complex with 27 or more lamellae each of which composed
flattened of dentine surrounded by enamel.

The evolutionary trends of elephants are summarizedas follows:

Inerease in size-allthe proboscidians became giant

2. Lengthening of the limb bones and the development of short, broad feet.

[Link] of skullto extra ordinary large size. it is to noted that the size of the skull
IS not increased by the development of brain but by the development of extensive
air cells or dipole.
 4. The shortening of the neck.
Since the skull and its
associated structures become
large and heavy the neck was
reduced in length to shorten the
lever between the body and the
heed.
Redont (ca Smjon par glode)

Elongation of the lower jaw.

In many cases there was a
secondary shortening of the
A
lower jaw.

6. Growth of a trunk Elongation htoenatodo (o0 rpeden

of the upper lips and nose
probably went along with
elongation of the lower jaw. Meetherum (a 50 npen jar gn)

7. Hyper-trophy of the second incisors to form tusk for defense and

fighting

8Limitations and specialization of the check teeth in various ways

daptations for chewing and grinding plant foods. Total number
of teeth is 28 as compared to the normal 44